Targeted-ads

From SMBC Wiki
Jump to navigation Jump to search
targeted-ads
If any of the information above relates to you personally, it's because my comic-production algorithm was successful.
Title text: If any of the information above relates to you personally, it's because my comic-production algorithm was successful.

Votey[edit]

1518628607-20180214after.png


Explanation[edit]

Run for your life.png This explanation is either missing or incomplete.

Transcript[edit]

Gday human.png This transcript was generated by a bot: The text was scraped using AWS's Textract, which may have errors. Complete transcripts describe what happens in each panel here are some good examples to get you started (1) (2).
[Describe panel here]
Targeted merchandise ads:
Weiiiiird.
Buy now!
Cool people went to nyu
Advanced targeted merchandise ads:
The hell?
Buynow!
Cool people were born november 1 1990, in lincounshire county by c-section
The horrible future:
Papa?
Buynow! Cool people's biological actually father stan was davies from across the street
smbc-comics.com

Votey Transcript[edit]

Gday human.png This transcript was generated by a bot: The text was scraped using AWS's Textract, which may have errors. Complete transcripts describe what happens in each panel here are some good examples to get you started (1) (2).
[Describe panel here]
Cool people have the genome: Cccccggcctcctgctgctgctgctctccggggccacggccaccgo
T cgcttggtggtttgagtggacctcccaggccagtgccgggccc
Ttctggaagaccttctcctcctgcaaataaaacctcacccatga igccattgtcccccggcctcctgctgctgctgctctccggggcca cccaccggccgagacagcgagcatatgcaggaagcggcaggaa [cgcttggtggtttgagtggacctcccaggccagtgccgggccq ggccaggcggcaggaaggcgcacccccccagcaatccgcgcgco ttctggaagaccttctcctcctgcaaataaaacctcacccatg
Cccaccggccgagacagcgagcatatgcaggaagcggcaggaa cgcttggtggtttgagtggacctcccaggccagtgccgggcci ggccaggcggcaggaaggcgcacccccccagcaatccgcgcgcq tctggaagaccttctcctcctgcaaataaaacctcacccatg. Gccattgtcccccggcctcctgctgctgctgctctccggggcca cccaccggccgagacagcgagcatatgcaggaagcggcaggaa1

Comment.png add a comment! ⋅ Comment.png add a topic (use sparingly)! ⋅ Icons-mini-action refresh blue.gif refresh comments!

Discussion

No comments yet!