Targeted-ads
Jump to navigation
Jump to search
| targeted-ads |
 Title text: If any of the information above relates to you personally, it's because my comic-production algorithm was successful. |
Votey
Explanation
|
This explanation is either missing or incomplete. |
Transcript
|
This transcript was generated by a bot: The text was scraped using AWS's Textract, which may have errors. Complete transcripts describe what happens in each panel — here are some good examples to get you started (1) (2). |
- [Describe panel here]
- Targeted merchandise ads:
- Weiiiiird.
- Buy now!
- Cool people went to nyu
- Advanced targeted merchandise ads:
- The hell?
- Buynow!
- Cool people were born november 1 1990, in lincounshire county by c-section
- The horrible future:
- Papa?
- Buynow! Cool people's biological actually father stan was davies from across the street
- smbc-comics.com
Votey Transcript
|
|
This transcript was generated by a bot: The text was scraped using AWS's Textract, which may have errors. Complete transcripts describe what happens in each panel — here are some good examples to get you started (1) (2). |
- [Describe panel here]
- Cool people have the genome: Cccccggcctcctgctgctgctgctctccggggccacggccaccgo
- T cgcttggtggtttgagtggacctcccaggccagtgccgggccc
- Ttctggaagaccttctcctcctgcaaataaaacctcacccatga igccattgtcccccggcctcctgctgctgctgctctccggggcca cccaccggccgagacagcgagcatatgcaggaagcggcaggaa [cgcttggtggtttgagtggacctcccaggccagtgccgggccq ggccaggcggcaggaaggcgcacccccccagcaatccgcgcgco ttctggaagaccttctcctcctgcaaataaaacctcacccatg
- Cccaccggccgagacagcgagcatatgcaggaagcggcaggaa cgcttggtggtttgagtggacctcccaggccagtgccgggcci ggccaggcggcaggaaggcgcacccccccagcaatccgcgcgcq tctggaagaccttctcctcctgcaaataaaacctcacccatg. Gccattgtcccccggcctcctgctgctgctgctctccggggcca cccaccggccgagacagcgagcatatgcaggaagcggcaggaa1
add a comment! ⋅ add a topic (use sparingly)! ⋅ 
refresh comments!
Discussion
No comments yet!